Journal: Molecules

Article Title: Subcritical Water Extract from Grape Pomace Protects Human Bronchial Epithelium Cells by Mitigating Oxidative Stress Through Nrf2 Pathway

doi: 10.3390/molecules31101736

Figure Lengend Snippet: SWE 160.1 treatment increased the antioxidant response. ( a ) Western blotting analysis of antioxidant factors (HO-1, SOD-2 and Nrf2) after 48 h of treatment with 75 and 100 µg GAE/mL SWE 160.1 in HBE cells. Protein levels were normalized to γ-tubulin. ( b ) qRT-PCR analysis of Nrf2, Keap1 and HO-1 mRNA levels after 24 h of treatment with 75 and 100 µg GAE/mL SWE 160.1 in HBE cells. Gene expression levels represent the relative mRNA expression compared to the untreated cells, normalized to GAPDH mRNA. ( c ) Western blotting of subcellular fractions of control and 48 h SWE 160.1 -treated cells incubated with pNrf2 (Ser40) antibody. Lamin A and GADPH antibodies marked as nuclei (N) and cytoplasmic (C) fractions, respectively. The images are representative of three different experiments. * p < 0.05, ** p < 0.01 vs. untreated control cells.

Article Snippet: The primers used were GAPDH (Proligo USA, Milan, Italy), Nrf2 ( HP209154 , OriGene Technologies, Inc., Rockville, MD, USA) and HO-1 ( HP205872 , OriGene Technologies, Inc., USA).

Techniques: Western Blot, Quantitative RT-PCR, Gene Expression, Expressing, Control, Incubation

Journal: Molecules

Article Title: Subcritical Water Extract from Grape Pomace Protects Human Bronchial Epithelium Cells by Mitigating Oxidative Stress Through Nrf2 Pathway

doi: 10.3390/molecules31101736

Figure Lengend Snippet: SWE 160.1 treatment overwhelmed LPS-induced HO-1-reduction. Western blotting analysis of HO-1 enzyme after 48 h of treatment with 2 µg/mL LPS alone or in combination with 100 µg GAE/mL SWE 160.1 . Protein levels were normalized to γ-tubulin. Densitometric analysis, performed using Quantity One software, (version 4.6.6), is shown in the histogram. The result is representative of two independent experiments, with values expressed as mean ± SD. ** p < 0.01 vs. untreated control cells.

Article Snippet: The primers used were GAPDH (Proligo USA, Milan, Italy), Nrf2 ( HP209154 , OriGene Technologies, Inc., Rockville, MD, USA) and HO-1 ( HP205872 , OriGene Technologies, Inc., USA).

Techniques: Western Blot, Software, Control

Journal: iScience

Article Title: PAR2-β-arrestin 2-ERK axis mediates Malassezia globosa -induced IL-17 response by disrupting ZO-1 in keratinocytes

doi: 10.1016/j.isci.2026.115646

Figure Lengend Snippet: Expression of PAR2, IL-17, and TJ proteins in Malassezia folliculitis (A and B) PAR2, IL-17, ZO-1, occludin, and claudin-1 were validated in MF and CTRL skin tissue by immunohistochemical staining (IHC). Values are mean ± SD of six samples from two independent experiments. Statistical analysis was performed using a two-way ANOVA with Šídák’s multiple comparisons test (∗ p < 0.05; ∗∗∗ p < 0.001). (C and D) The spores rate of CTRL and MF groups by Periodic Acid-Schif staining. Purple arrows indicate the spores. Scale bars, 50 μm. Data are presented as mean ± SD of triplicate wells from three independent experiments. Statistical significance was determined using unpaired two-tailed Student’s t tests (∗∗ p < 0.01).

Article Snippet: Primer of Claudin-1 (Forward, 5′-AGGTACGAATTTGGTCAGG CTCTC-3’; Reverse, 5′-GGGAC AGGAACAGCAAAGTAGGG-3′) , Sangon Biotech , N/A.

Techniques: Expressing, Immunohistochemical staining, Staining, Two Tailed Test

Journal: Scientific Reports

Article Title: Experimental pulmonary arterial hypertension in mice with a pathogenic SOX17 variant

doi: 10.1038/s41598-026-46893-0

Figure Lengend Snippet: Graphical abstract. AhR, aryl hydrocarbon receptor; Bmpr2, bone morphogenetic protein receptor type 2; Col4a, collagen, type IV, alpha; Cyp1b1, cytochrome P450 family 1 subfamily B member 1; SOX17, SRY-box transcription factor 17. Created in https://BioRender.com .

Article Snippet: The primers used were as follows: F: TGCACCACCAACTGCTTAG and R: GGATGCAGGGATGATGTTC for glyceraldehyde-3-phosphate dehydrogenase ( Gapdh ) as an endogenous control gene; F: GCCACTATTACGGACATCTTCGG and R: ACAACCTGGTCCAACTCAGCCT for cytochrome P450 family 1 subfamily B member 1 ( Cyp1b1 ) (SKU MP203248, ORIGENE, MD, USA); F: AAGCTGCTGGAGCTGATTGG and R: AACTGGACGCTCATCCAAGG for Bmpr2 ; F: CTGGCACAAAAGGGACGAG and R: ACGTGGCCGAGAATTTCACC for collagen , type IV , alpha 1 ( Col4a1 ) ; and F: CCCGGATCTGTACAAGGGTG and R: TGATGCCTTCCTCGCCTTTT for collagen , type IV , alpha 2 ( Col4a2 ) .

Techniques:

Journal: bioRxiv

Article Title: Orally Delivered dsRNA-Derived siRNAs Reach the Central Nervous System in Leptinotarsa decemlineata

doi: 10.64898/2026.03.11.711085

Figure Lengend Snippet: (a) Length distribution of RISC-associated small RNAs recovered from the CNS 24 h after dsmGFP exposure, showing a dominant 21-nt siRNA peak. (b) Strand-specific mapping of 21-nt siRNAs from the CNS sample onto the dsmGFP template, revealing a major antisense hotspot similar to that observed in CPB tissues. (c) Length distribution of RISC-bound small RNAs from the remaining tissues, demonstrating a tissue-specific shift to a predominant 22-nt siRNA population. (d) Strand-specific mapping of 22-nt siRNAs from the remaining tissues sample, showing relocation of the dominant antisense hotspot to a secondary region of the dsmGFP sequence.

Article Snippet: Libraries from purified small RNAs (∼500 ng RNA per sample) were prepared using the NEBNext® Multiplex Small RNA Library Prep Kit (NEB #E7560S), following the manufacturer’s instructions.

Techniques: Sequencing